Edible sea cucumber species identification method based on DNA mini-barcode technology

A micro-barcode and species identification technology, applied in the field of molecular biology, can solve problems such as destruction and inability to extract COI genes, and achieve the effects of simple operation, species identification, and high accuracy

Active Publication Date: 2018-05-11
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in some processed foods, the complete COI gene cannot be extracted due to the damage of its DNA. A

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Edible sea cucumber species identification method based on DNA mini-barcode technology
  • Edible sea cucumber species identification method based on DNA mini-barcode technology
  • Edible sea cucumber species identification method based on DNA mini-barcode technology

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0012] The present invention is further explained by way of examples, but the present invention is not limited to the following examples.

[0013] In this example, the following experiments are used to evaluate the amplification efficiency and identification accuracy of the DNA micro-barcoding of sea cucumbers.

[0014] 1. Primer design

[0015] Download the COI gene sequences of different types of edible sea cucumbers from the NCBI website and use

[0016] MEGA6.0 software performs multiple alignments of sequences, removes the same sequence, and finds conserved regions. A pair of DNA microbarcoding primers MiniCOI-F:CATGGCTTTCCCTCGAATGAA, MiniCOI-R:TAACTCCTGGGGTTCGCATCT were designed by using conservative regions and primmer5.0 software.

[0017] Table 1 PCR primers and their annealing temperature

[0018]

[0019] 2. Extraction of sample genomic DNA

[0020] For 28 sea cucumber samples with known species information, the improved CTAB method was used to extract sea cucumber DNA. Dried sea

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to an edible sea cucumber species identification method based on a DNA mini-barcode technology. According to the method, PCR amplification is performed through sea cucumber genome DNA extraction by use of a DNA mini-barcode primer, a PCR product with the length of 257 bp is obtained, wherein the DNA mini-barcode primer is MiniCOI-F:CATGGCTTTCCCTCGAATGAA; MiniCOI-R:TAACTCCTGGGGTTCGCATCT. Finally, DNA mini-barcode fragment sequences obtained through sequencing are compared in the NCBI (National Center for Biotechnology Information), and strain identification is performed according to matching similarity of the sequences. The method is simple and convenient to operate and high in accuracy and can identify processed commercial sea cucumbers with disappeared morphologicalfeatures, and a technical support is provided for maintaining benefits of enterprises and consumers and normal market orders.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Owner CHINESE ACAD OF INSPECTION & QUARANTINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap