RXRalpha (Homo Sapiens Retinoid X Receptor alpha) gene knockout cell system with stable and low expression of RXRalpha protein and preparation method of RXRalpha gene knockout cell system
A gene knockout and α gene technology, applied in the field of biological preparation, can solve the problems of low probability of occurrence and high fidelity, achieve good reproducibility, simplify procedures, improve reliability and research efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] (1) Setting of RXRα gene knockout target site and design of gRNA
[0036] According to the RXRα gene sequence, select the common exon4 of RXRα-a / b / c as the knockout target sequence, and design the CRISPR target site, such as figure 1 The position indicated by the arrow is selected for knockout site;
[0037] The selected knockout target sites are bases 1-180 of exon 4 of the RXRα gene, and the DNA was designed with bases 44-66 (CTTCAAGCGGACGGTGCGCAAGG), 79-101 (CCTGCCGCGACAACAAGGACTGC), and 106-128 (TTGACAAGCGGCAGCGGAACCGG) Oli gos primers to synthesize double-stranded gRNA.
[0038] Use online software to design CRISPR knockout gRNA and synthesize complementary DNAOligos primers, see figure 2 The indicated gRNA sequence design.
[0039] figure 2 Among them, Guid#1-#5 are the high-scoring knockout target sites selected by the software design respectively. In this project, Guid#1, #2, and #5 are selected to design gRNA synthesis primers, and the corresponding prim
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap