Corynebacterium glutamicum for producing gamma-aminobutyric acid, and building method and application thereof

A technology of Corynebacterium glutamicum and aminobutyric acid, applied in the field of genetic engineering, to achieve the effect of reducing production costs and high-efficiency production

Inactive Publication Date: 2018-02-09
ZHANG ZHOU HALTH VOCATIONAL COLLEGE
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This technology allows for better ways to make certain compounds from amino acids through biosynthesis processes. It involves incorporating genes involved with enzyme reactions called GADs (genetic code) or other proteins like histidine translocases into plants' root cells during their growth cycle. These techniques allow for more precise control over how these chemical substances are produced within crops compared to traditional methods such as breeding them out. Overall this results in improved yields and reduced cost per unit productivity.

Problems solved by technology

Technologies aim to develop new methods for improving the efficiency of chemical reactions involved in making certain compounds from sugars like sugarcane. These techniques involve modifying existing chemistry processes involving yeast cultures and introduces specific types of lactic acid bacteria called lanthiongardilicate(LAL), beta-lactone mononitrocylic lyser phosphorus hydride complex, ylacrithochloridomycetic acid, xiamycete gramule culture, and others.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Corynebacterium glutamicum for producing gamma-aminobutyric acid, and building method and application thereof
  • Corynebacterium glutamicum for producing gamma-aminobutyric acid, and building method and application thereof
  • Corynebacterium glutamicum for producing gamma-aminobutyric acid, and building method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0060] A method for constructing a Corynebacterium glutamicum producing γ-aminobutyric acid, comprising the steps of:

[0061] (1) Design of primers

[0062] According to the glutamic acid dehydrogenase gdh gene sequence design PCR required primer P1gdh and P2gdh of the corynebacterium glutamicum bacterial strain registered in gene database GenBank; The gene sequence of described primer P1gdh is CG GAATTC ATGACAGTTGATGAGCAGGTCT, wherein the underline is the enzyme cutting point of EcoRI; the gene sequence of the primer P2gdh is GC GTC GAC TTAGATGACGCCCTGTGCCAGCA, where the underline is the restriction site of sal Ⅰ;

[0063] According to the glutamic acid decarboxylase gadB gene sequence design PCR required primer P1gadB and P2gadB of the lactobacillus plantarum strain registered in gene database GenBank; The gene sequence of described primer P1gadB is: CG GAATTC ATGGCAATGTTATACGGTAAAC, wherein the underline is the enzyme cutting point of EcoRI; the gene sequence of the primer

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a corynebacterium glutamicum for producing gamma-aminobutyric acid, and a building method and application thereof. A glutamate decarboxylase gene gadB for synthesizing gamma-aminobutyric acid in lactobacillus plantarum and a glutamate dehydrogenase gene gdh for synthesizing L-glutamic acid in corynebacterium glutamicum are subjected to tandem expression and are guided intothe corynebacterium glutamicum; the corynebacterium glutamicum for producing gamma-aminobutyric acid produced by fermenting the corynebacterium glutamicum subjected to the gene tandem expression can effectively achieve the goal of efficiently producing gamma-aminobutyric acid by a biological method; safety and reliability are realized; and the production cost can also be obviously reduced.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Owner ZHANG ZHOU HALTH VOCATIONAL COLLEGE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap