Efficient amplification method for bisulfite sequencing PCR (BSP) fragments of plant gene promoters

[0019] Example 1

[0020] A method for efficiently amplifying BSP fragments of plant gene promoters, characterized in that it comprises the following steps:

[0021] S1, design and artificially synthesize corresponding primer pairs according to the GC islands and high GC content regions of plant gene promoters;

[0022] S2, select the outermost primer combination of the two ends of the promoter to perform the first round of PCR amplification on the gene promoter, and 33 cycles of high-fidelity enzyme amplification. The specific cycle program is determined according to different plant species to obtain the first round of PCR products;

[0023] S3, the first round of PCR product was diluted with water by 10 times as a template, and a set of primers on the inner side was selected according to the size of the target fragment to be amplified for the second round of PCR amplification, high-fidelity enzyme amplification 35 cycles , The specific cycle program is determined by different plant spe

[0024] Example 2

[0025] Taking Arabidopsis as an example, the Arabidopsis FWA gene promoter BSP fragment was amplified. The DNA sequence of the Arabidopsis FWA gene promoter BSP fragment is as follows:

[0026] 5'-tttcggtcaatacaattttataatctttcattttttctatcatttcatatcattgtaactataaattttcgtaaatagacctttagtgttaatacaatagatttttattaattttatatcggattttgtttaaaaaagaaaaaccataggatggatgatgattggtacttataagattgtaattgggtatttttggattgttaccaccattacaaagctattaacagagattgaagatatcacacaatgagagcgccacagcttcagcaacgtcccatgcagctgatgtgccttcgcctttctcttcctcatctgcgcttataaataaggcaaagcaactagaaaagattaaaaccaaaaccaaaacaaaaaactagttaagaccctgattttgtttcataggtacatacacttttcaacattgatttttgttgttaaaaataaaatccatgtgaaggttctcatcatataccgaaagaatgggaaatttgaaaattccatacttttttaaaaagacaatttgttttatcactttagtttttttatatattcagcgtctaccaaatctacacttttttttctttctcgatttagttaatcttcgttcttgtgtcatgtaatagattactatttcaaaacatagatatttagttatctaaataaaactaggccatccatggatggtttcaattttttttttcatatgaaagaaaagttaaatttcatttcacaataaccattgattactaaatttagtaaagaatcaattgggtttagtgtttact