Method for constructing pSU6-miR-122 vector expressing miR-122 and application of pSU6-miR-122 vector

[0023] Below in conjunction with accompanying drawing, the present invention is described in further detail:

[0024] A construction method that can be used to express miR-122 vector pSU6-miR-122, the steps are:

[0025] a. Chemically synthesized oligonucleotide strand, sense strand (SEQ ID NO.1): 5’-GGATCCAGCTGTGGAGTGTCGAAATGGTGTTTGTGTCCAAACTATCAAACGCCATTTCAACACTAAATAGCTTTTTTGGAAA-3’

[0026] Antisense strand (SEQ ID NO.2): 5'-AGCTTTCCAAAAAAGCTATTTAGTGTTGAAATGGCGTTTGATAGTTTGGACACAAACACCATTTCGACACTCCACAGCTGG is complementary to the sense strand, and AGCT is added at the 5' end to create sticky overhangs.

[0027] b. The sense strand and antisense strand anneal to form a band BamHI and Hind III cohesive-ended fragments;

[0028] c. Ligate the fragment obtained in step b to the vector pSilencer-2.1-U6 (purchased from Ambion: the vector is made of BamHI and Hind III double digestion);

[0029] d. Transform Escherichia coli Stbl3 competent cells (the Stbl3 strain was purcha

[0033] A kind of vector pSU6-miR-122 expressing miR-122 is used in the preparation of the medicine for treating or preventing hepatitis B virus, and its steps are:

[0034] A. pSU6-miR-122 inhibits the expression of hepatitis B virus HBsAg and HBeAg:

[0035] B. Transfect HepG2.2.15 cells with pSU6-miR-122, detect HBsAg and HBeAg with ELISA kit after 24 hours (the detection kit was purchased from Shanghai Kehua Bioengineering), the level of HBsAg decreased by 67.3%, and the level of HBeAg decreased by 78.5% .

[0037] An application of expressing miR-122 carrier pSU6-miR-122 in the preparation of medicines for treating or preventing hepatitis B virus, the steps are:

[0038] A, pSU6-miR-122 inhibits the transcription and viral replication of the hepatitis B virus genome, and co-transfects HepG2 cells with pSU6-miR-122 and the expression vector pHBV1.3 with 1.3 times the length of the HBV gene;

[0039] After 24 hours, the level of hepatitis B virus genomic DNA (cccDNA) linked to capsid was detected by qRT-PCR and decreased by 85.2% (the detection kit was purchased from Shenzhen Piji Company).