Increased triacylglycerol production in microalgae

Example 1: Effect of Overexpression of the Endogenous NOA Gene on Triacylglycerol Production in Phaeodactylum tricornutum

Material and Methods

[0112]Phaeodactylum tricornutum (Pt1) Bohlin Strain 8.6 CCMP2561 (Culture Collection of Marine Phytoplankton, now known as NCMA: National Center for Marine Algae and Microbiota) was used in example 1.

Genetic Construct for PtNOA Overexpression

[0113]Genomic DNA was extracted from Phaeodactylum tricornutum Pt1 strain using the following procedure: 100·106 cells were harvested and frozen in liquid nitrogen. A volume of 20 μl Edward-Buffer (Tris-HCl 200 mM, pH 7.5; NaCl 250 mM; EDTA 25 mM; SDS 0.5%, w / v) was added, then samples were homogenized and debris removed by centrifugation. The supernatant was transferred to the same volume of isopropanol to precipitate DNA. After an additional 15 minute centrifugation at 10,000×g, the pellet was washed with ethanol 70%, dried and solubilized in TE buffer (10 mM Tris-HCL pH7, 1 mM EDTA). DNA concentration wa

Example 2: Overexpression of a PtNOA Homolog from Nannochloropsis gaditana (NgNOA) in P. tricornutum and N. gaditana

[0124]A PtNOA homolog (FIG. 1A) is present in Nannochloropsis gaditana (NgNOA; SEQ ID NO:3 and SEQ ID NO:4 for the nucleotide and amino acid sequence, respectively).

[0125]For the heterologous expression of NgNOA in Phaeodactylum tricornutum and the overexpression in Nannochloropsis gaditana, the coding sequence was optimized to match the codon optimization of both Chromalveolata species. Restriction sites for BamHI and Xbal were added at the 5′-end, and EcoRI and NdeI at the 3′-end of the codon optimized CDS to allow expression in the pH4 vector for expression in P. tricornutum, and in the PCT2Ng vector (SEQ ID NO:7) for the expression in N. gaditana, respectively. The codon optimized NgNOA coding sequence is designated as NgNOAoptCDS and has the following sequence:

(SEQ ID NO: 5)GGATCCTCTAGAATGGCTCCCCACCTCTCCGGCCTCAACTTCCACTCCCTCGTCAAGCGCTCCTCCGCTGCTGCTCTCCTCTTCTCCCTCTTC