Stably expressed anti-interferon gamma genetically engineered single-chain antibody strain and application

A single-chain antibody and genetic engineering technology, applied in genetic engineering, application, plant genetic improvement, etc., can solve problems that have not been reported

Active Publication Date: 2018-05-22
FUJIAN AGRI & FORESTRY UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patented method allows us to produce highly pure proteins called IL-17Ra (interferon gamma) which have potential applications in medicine or biotechnology. These methods involve creation of cells with specific genes from certain sources, followed by manipulation such as introductions into bacteria or other organisms containing these genes. By adding different types of DNA sequences together they may be able to generate various forms of molecules like those used during inflammatory responses. They also allow them to bind specifically to their target receptors on lymphocytes, resulting in increased sensitivity when detecting low levels of interference signals between similar targets. Overall, this new technique provides technical means for producing effective drugs against autoimmune diseases through testing patient serum sample fluids alongside infectious agents.

Problems solved by technology

This patented technical problem addressed in this patents relates to improving the accuracy and speed at which current tests such as ELISA or Western Blotting require long periods of time and expensive equipment. There currently exist commercially available assays like those described earlier, but they lack certain features necessary for use in routine medical practice settings due their complexity and instability.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Stably expressed anti-interferon gamma genetically engineered single-chain antibody strain and application
  • Stably expressed anti-interferon gamma genetically engineered single-chain antibody strain and application
  • Stably expressed anti-interferon gamma genetically engineered single-chain antibody strain and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] 1. Preparation and identification of the single-chain antibody of the present invention.

[0030] 1. Expression and purification of interferon-γ antigen

[0031] In this experiment, the DNA sequence of interferon γ antigen will be used as a template, and specific primers (IFN-γ-F:CAAGAATTCTGTTACT GCCAGGACCCATATGT; IFN-γ-R:TTAAAGCTTCTGGGATGCTCTTCGACCTCGA) will be designed for PCR amplification. Digested with enzymes, connected with the prokaryotic expression vector pET28a with the same restriction enzymes, and constructed the recombinant expression vector pET28a- IFN-γ. Transform Escherichia coli competent cells BL21, induce expression with IPTG (concentration: 1mM / L), and pass Ni 2+ High-purity IFN-γ antigen protein was obtained by affinity chromatography. Specific steps are as follows:

[0032] 1), IFN-γ Gene amplification reaction system:

[0033] PCR mixture 25 µL

[0034] IFN-γ -F(20 mM) 0.5 µL

[0035] IFN-γ -R(20 mM) 0.5 µL

[0036] Template DNA 2 µL

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Affinityaaaaaaaaaa
Login to view more

Abstract

The invention belongs to the field of antibody engineering, and particularly relates to a stably expressed anti-interferon gamma (IFN-gamma) genetically engineered single-chain antibody strain and application. A gene of an interferon gamma is cloned in vitro through a genetic engineering measure to build a prokaryotic expression vector; isopropyl thiogalactoside (IPTG) induction, expression and purification are performed to obtain soluble interferon antigen protein. The anti-(IFN-gamma) genetically engineered single-chain antibody strain capable of realizing stable secretory expression is selected by using a phage display technology, and a functional single-chain antibody is expressed and purified by building the prokaryotic expression vector; by use of a competitive enzyme-linked immunosorbent assay (ELISA) method, qualitative and quantitative detection for IFN-gamma in human body is realized; a foundation is laid for commercial development and production of a high-quality enzyme-linked immunosorbent assay kit and a gold-labelled antibody detection card.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Owner FUJIAN AGRI & FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap