Indel marker linked with cucumber long hypocotyledonary axis gene lh1, primer for screening cucumber long hypocotyledonary axis gene lh1, kit for identifying cucumber germplasm resources with cucumber long hypocotyledonary axis gene lh1, and application of Indel marker

[0097] Experimental example 1. Acquisition of Indel marker closely linked to long hypocotyl gene lh1 of cucumber AM149L

[0098] Combined with cucumber genome sequence data and AM149L resequencing data, using bioinformatics combined with phenotypic identification of genetic populations to analyze and locate fragment differences in this region, four base deletions were found in cucumber AM149L material.

[0099] Based on the obtained Indel marker closely linked to cucumber AM149L long hypocotyl gene lh1, an Indel marker closely linked to cucumber AM149L long hypocotyl gene lh1 (named LH1-INDEL2) was developed. The forward and reverse primers are:

[0100] LH1-INDEL2-F: AGAGTCCTTTGAGTGGTATACG

[0101] LH1-INDEL2-R: AGAACAACTCACCCATCATCAA

[0102] Due to the relationship of inserting Indel, through the above primers (LH1-INDEL2-F / LH1-INDEL2-R), the cucumber material AM149L and 172 cucumber germplasm resources of different types were PCR amplified to obtain specific bands, among

[0111] Experimental example 2. Verification of the flanking marker of the long hypocotyl gene lh1 in cucumber AM149L

[0112] Using the 172 different types of cucumber germplasm resources preserved in this project, the LH1-INDEL2 marker linked to the gene lh1 obtained in Example 1 was verified to determine the accuracy of the marker for molecular marker-assisted selection: Compared with the hypocotyl phenotype of the selected materials ( figure 1 ), it was found that the phenotype data reflected by the marker in 172 different types of cucumber germplasm resources were consistent with the results of the hypocotyl phenotype investigation ( figure 2 ), the calculated accuracy rate is 100%.