Single-chain antibody for targeting Reg3A

[0029] Example 1 Phage Antibody Library Screening Anti-Reg3A Single Chain Antibody

[0030] 1. Antigen Reg3A

[0031] The Reg3A protein (Q06141-1) used in the present invention is purchased from Beijing Yiqiao Shenzhou Biotechnology Co., Ltd., which contains 175 amino acids and has a purity of >97%.

[0032] 2. Preparation of Escherichia coli host strain TG1 with sex cilia

[0033] TG1 was streaked from the plate in the glycerol cryopreservation tube, inoculated on the M9 medium plate, and cultured upside down at 37°C for 36 hours. Pick a single clonal colony, inoculate it in 5ml 2×YT medium, and cultivate overnight at 37°C on a shaker. The next day, 1 / 100 dilution was inoculated in fresh 2×YT medium, and cultured on a shaker at 37°C to logarithmic phase (OD 600 0.4-0.6), and then infected with phage.

[0034] 3. Preparation of Helper Phage

[0035] Add the helper phage to 200 μL TG1 bacterial culture solution (OD 600 0.5), after 30 minutes in a water bath at 37°C, add it

[0055] Example 2 Sequencing and analysis of Reg3A scFv

[0056] Sequencing results showed that five Reg3A scFv gene sequences were successfully obtained, using IMGT / V-QUEST ( http: / / www.imgt.org / ) analyzed the Reg3A scFv gene sequence, and the analysis results showed that: the heavy and light chain variable regions of the Reg3A scFv named A5 and their CDR1-3 region gene sequences are shown in SEQ ID NO.1-8; the Reg3A scFv heavy named C2 1, the gene sequence of the light chain variable region and its CDR1-3 regions are shown in SEQ ID NO.9-16.

[0057] Preparation and purification of embodiment 3 Reg3A scFv

[0058] PCR amplification of Reg3A scFv gene

[0059] The Reg3A scFv gene was amplified by PCR using the single clone screened from the phage library and correctly sequenced and analyzed as a template. EcoR I and Xho I were selected as upstream and downstream restriction sites respectively, and primers were designed using Primer5.0, wherein the sequences of A5-F, C2-F (upstream primers) and A5-R, C2-R (downstream primers) were:

[0060] A5-F CCGGAATTCCAGGTGGCAGCTGCAGGAGT

[0061] A5-R CCGCTCGAGACGTTTGATATCCACTTTGGTCCC

[0062] C2-F CCGGAATTCTCCAGGTACCTTGAAGGAGTCTGG

[0063] C2-R CCGCTCGAGACGTTTGATCTCCACCTTGGTCC

[0064] The reaction system was 50 μL, and the reaction conditions were 94°C for 4 min, 94°C for 30 s, 57°C for 45 s, 72°C for 1 min, 29 cycles, 72°C for 10 min, and storage at 4°C. Take 5 μL of the final product for identification on 1% agarose gel electrophoresis. Reg3A scFv gene of about 750bp was am