Quick subtype detection method for HPV in urine

A detection method and urine technology, applied in the field of genetic diagnosis, can solve problems such as subtle damage of cervical and vaginal epithelial tissue, and achieve the effect of simplified operation, easy acceptance and simple acceptance

Inactive Publication Date: 2019-08-30
NANJING GEZHI GEMONICS CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method is relatively direct, simple and fast, but there are still some problems in its promotion: First, although cervical cell sampling is a non-invasive test, the requirements for sampling are relatively high, and it is easy to cause slight damage to the cervical and vaginal epithelial tissues, and most of them need to be operated in a hospital. ; In addition, most women still resist cervical cell sampling due to privacy concerns

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0025] In order to further understand the content of the present invention, the present invention will be described in detail below in conjunction with specific examples.

[0026] Pre-amplification treatment: 50ml of urine was directly centrifuged at 3000g for 5min, the supernatant was discarded and the precipitate was washed once with PBS, 50ul of lysate was added, heated at 95°C for 10min, and then centrifuged at 13000g for 10min at high speed again, and the supernatant was directly taken for qPCR.

[0027] The qPCR primer and probe sequences are listed in the table below:

[0028] Primers / Probes sequence 16F ggaggaagaggatgaaatagatggt 16R agagtcacacttgcaacaaaaggt 18F caggcagattttgtgaaagctaga 18R aaccgtggacttaactctgtatcca 16 Probes fam-aaccggacaagcagacagagcccat-bhq1 18 Probes HEX-gcattgttacagcacagccatgcg-BHQ2

[0029] The two types are multiplexed in the same amplification system (10ul):

[0030] components vo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a quick subtype detection method for HPV in urine. The quick subtype detection method sequentially comprises the following steps of (1) centrifuging urine, discarding supernatant, taking precipitate cells, cleaning the taken precipitate cells with PBS, adding lysate, performing heating, then performing high speed centrifugation once again, taking supernatant, and performing subsequent qPCR; (2) performing qPCR amplification on a qPCR system consisting of a buffer solution, multiple DNA polymerases, mixed primers, mixed probes, the supernatant in the step (1) and water;and (3) detecting amplification products. According to the quick subtype detection method for HPV in urine provided by the invention, quick qPCR is adopted for detecting the HPV, and subtype is performed; according to the method, DNA extraction is not needed, so that cost can be saved, and the operation can be simplified; and when the detection is performed by the method, the detection can be performed only when urine samples are collected, and collecting urine samples is simpler and easier to accept compared with a traditional method of collecting vaginal secretion.

Description

technical field [0001] The invention belongs to the technical field of gene diagnosis, and in particular relates to a urine HPV rapid typing detection method. Background technique [0002] Cervical cancer is one of the common female malignant tumors, its incidence is second only to breast cancer, ranking second in gynecological tumors. Scientific research has confirmed that persistent infection of high-risk papillomavirus (hrHPV) is the main cause of cervical cancer, and HPV-negative women have an extremely low risk of cervical cancer. However, most women who test positive for HPV do not develop precancer or cancer, and only a minority of women with HPV infection are at risk of developing cervical precancer. [0003] HPV detection can mainly check whether you are infected with HPV through staining microscopy, HPV DNA detection or serological tests. The mainstream detection is still through cervical cell sampling for total DNA extraction, followed by HPV qPCR typing detecti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6851C12R1/93
CPCC12Q1/708C12Q1/6851C12Q2531/113C12Q2537/143
Inventor 林东旭刘小龙
Owner NANJING GEZHI GEMONICS CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap