Reagent kit for Coxsackie virus CA10 type fluorescent quantitative PCR detection

[0057] This embodiment provides a Coxsackievirus CA10 type fluorescent quantitative PCR detection kit, which includes the following components: RNA extraction solution, RNA eluent, RT-PCR enhancer, internal standard, PCR reaction solution, CA10 positive Reference substance, CA10 negative control substance, wherein, the internal standard is a recombinant of a 320 base pair artificially synthesized DNA sequence inserted into the pUC18T vector, and the concentration is 1.00E+04copies / ml~5.00E+04copies / ml ; The sequence of 128 base pairs is as follows:

[0058] 5'-GTCCAGTACTTTCAAAGCTCGATCCCGGTAACTACCAAATCGGTACGTACCGGTTTAAAACCACCGATCGCCTCTTCCCAACCTGTACGTACGTACGTACGTCCAAAAGTTTCCACGTACGATCGATC-3'.

[0059] The RNA extraction solution comprises the following components:

[0060] RNA extraction solution I: sodium dodecyl sulfate, mass / volume 0.2%~1.0%, triton, volume / volume 1.0%~4.0%, guanidine isothiocyanate 0.2mol / L~1.0mol / L, 100μg / ml~400μg / ml magnetic beads;

[0061] RNA extract...

[0103] This embodiment provides a Coxsackievirus CA10 type fluorescent quantitative PCR detection kit, which is composed of the same kit as in Example 1, and the detection steps and methods are also the same as in Example 1, and is used to detect and detect other hand-foot-mouth viruses and Enteroviruses, as a result of image 3 Shown in the figure is the background noise peak of the amplified non-CA10 virus.

[0104] Depend on image 3 The analysis shows that this kit has no amplification curve for normal human throat swab samples, or CA16, CA6, CA7, CA9, CB2, CB5, CBl3, ECH019 and EV71 infected samples, and the test results are all negative, and the negative coincidence rate is 100%, indicating that the kit has good specificity and high accuracy.

[0106] This embodiment provides a Coxsackievirus CA10 type fluorescence quantitative PCR detection kit, its composition is the same as the kit in Example 1, and the detection steps and methods are also the same as in Example 1, the internal standard amplification curve of the kit Figure such as Figure 4 As shown, it shows that the PNA extraction and amplification method of the detection kit provided in this embodiment will not produce substances that inhibit the specific PCR reaction, and can effectively monitor the reaction.