Reagent kit for detecting clear renal cell carcinoma

[0058] Embodiment 1: the acquisition of albumen

[0059] According to the eukaryotic expression method in the prior art, the corresponding protein is obtained. For example, using a method similar to that in (Using Insect Baculovirus to Express DUSP1 and Its Effect on Tumor Cells), the protein was harvested, and a protein stock solution with a DUSP-9 protein concentration of 50 mg / mL was obtained by protein concentration technology.

[0060] Example 2 Nucleic Aptamer Screening

[0061] From a random oligomeric DNA library synthesized in vitro, (5'-TTGACAGGGAGCATTAGCAT-N35-GCATTACCATGAAGTTGCAC-3'), wherein N35 is 35 random oligonucleotides;

[0062] Primer P1: TTGACAGGGAGCATTAGCAT; Primer P2: GTGCAACTTCATGGTAATGC.

[0063] (1) 1 mg of DUSP-9 protein was dissolved in 200 μl of PBS, added to a 96-well ELISA plate, and left overnight at 4°C.

[0064] (2) After the protein-coated wells were washed 6 times with PBS, 200 μl of 3% BSA (purchased from Shanghai Sangong) was added and incubated for 2 hours. At the same time, 200 μl of 3% BSA was added to a blank 96-well ELISA plate and incubated at 37° C. for 2 hours.

[0065] (3) The random ssDNA library (800 pmol in the first round) was dissolved in 200 μl 1*SHCMK, and denatured at 95° C. for 5 minutes. Immediately place it on ice for 10 minutes, and let it cool down to room temperature rapidly to avoid renaturation of ssDNA into double strands.

[0066] (4) Add...

[0078] Embodiment 3 degradation activity analysis

[0079] Human serum albumin, DUSP-1 protein, DUSP-10 protein, DUSP-14, and 22 aptamers were used for specific detection. After binding experiments, it was found that none of these aptamers combined with these proteins, but only Binding to DUSP-9 protein maintains high specificity.

[0080] 0.2ug of the aptamer was taken and placed in normal temperature serum and aqueous solution respectively for two weeks. Through RT-PCR detection, it was found that its structure was stable and not degraded after three weeks of storage.