Application of stilbene compounds in treating and preventing AIDS

[0038] Example 1 Expression, purification, protein activity detection and IC of HIV-1 protease 50 Determination of value

[0039] (1) Amplification of HIV-1 protease fragment and construction of expression vector

[0040] Design primer PCR to amplify the HIV-1 protease coding fragment, recover the PCR product and pET-11a vector and digest it with Nde I and BamH I, recover the target fragment, connect the digested fragment with the linearized vector and transform E. coli.DH5α competent cells. The transformed clones were picked for PCR identification, and the positive clones were subjected to DNA sequencing.

[0041] Gene sequence of HIV-1 protease:

[0042] cctcagatcactctttggcaacgaccccctcgtcacaataaagataggggg

[0043] gcaactaaaggaagctctattagatacaggagcagatgatacagtattag

[0044] aagaaatgagtttgccaggaagatggaaaccaaaaatgatagggggaat

[0045] tggaggttttatcaaagtaagacagtatgatcagatactcatagaaatctg

[0046] cggacataaagctataggtacagtattaggtaggacctacacctgtcaacat

[0047] aattggaagaaatct...

[0054] Example 2 Isolation of HIV-1 protease inhibitors from sausage beans

[0055] 30 grams of 95% ethanol extract of sausage bean was dispersed with 1.4 times of double-distilled water for 2 hours, poured into a separatory funnel, and extracted with petroleum ether, dichloromethane, ethyl acetate and n-butanol in sequence , fully shaken, left to stand for 6 hours, extracted 3 times with each solvent, separated the organic phase and the aqueous phase, and the extract was concentrated with an EYELA N1001 rotary evaporator, and the obtained dry paste sausage soya bean ether, dichloromethane, Ethyl acetate and n-butanol extraction samples, as HIV protease inhibitors in vitro screening and separation samples.

[0056] The inhibitory effect of the extracts of the above four solvents on HIV protease was tested at a drug concentration of 0.5mg / ml, and it was found that the ethyl acetate extract had better inhibitory activity, so the ethyl acetate extract was selected as the next ste...