Nucleic acid aptamer capable of detecting human colon cancer and application thereof in preparing detection preparations

[0029] Example 1: Determination of sequences with the highest binding ability to colon cancer cell lines

[0030] First, all the sequences in the Swan library were diluted with DPBS to a final concentration of 250nM, denatured at 95°C for 5min, refolded on ice for 10min, and then placed at room temperature. Secondly, the adherent colon cancer cells were digested from the culture dish with 0.2% EDTA and collected into centrifuge tubes, washed and centrifuged several times with washing buffer (DPBS, 0.45% glucose, 5 mM magnesium chloride) . Then add the prepared aptamer sequence and binding buffer (Binding Buffer: DPBS, 0.45% glucose, 5 mM magnesium chloride, 100mg / L tRNA, 1g / L BSA) to the cells respectively. The whole mixed system was incubated on a shaker at 4°C for 1 h, then washed and centrifuged twice with washing buffer (Washing Buffer: DPBS, 0.45 % glucose, 5 mM magnesium chloride), and finally the fluorescence was detected by flow cytometry (results in figure 1 ). Tes...

[0031] Embodiment 2: DML7 specifically recognizes colon cancer cells

[0032] This experiment was similar to that of Example 1. Firstly, the DML7 and control sequences were diluted with DPBS to a final concentration of 250nM, and then denatured and refolded. Then, colon cancer cells (HCT116, HT29, LoVo, Caco2, SW620, HCA7, DLD1) and human normal intestinal epithelial cells (FHs74Int, NCM460) attached to the culture dish were digested with 0.2% EDTA and collected. In a centrifuge tube, wash several times by centrifugation with washing buffer (Washing Buffer: DPBS, 0.45% glucose, 5 mM magnesium chloride). Add the prepared DML7 and control sequences to colon cancer cells (HCT116, HT29, LoVo) and human normal intestinal epithelial cells (FHs74Int, NCM460) respectively, and add binding buffer (Binding Buffer: DPBS, 0.45% glucose, 5 mM MgCl, 100mg / L tRNA, 1g / L BSA). The mixed system was incubated on a shaker at 4°C for 1 h. After incubation, it was washed and centrifuged twice wi...

[0033] Embodiment 3: the method for truncating DML7 sequence

[0034] Deletion and optimization of DML7 was performed as follows (the underlined part is the conserved nucleotide sequence of DML7):

[0035] The full length of the DML7 sequence is:

[0036] 5'-ACGCTCGGATGCCACTACAGG TTGGGGTCGGGCATGCGTCCGGAGAAGGGCAAA CGAGAGGTCACCAGCACGTCCATGAG-3'.

[0037] : (Delete 11 bases from the primer region on the left)

[0038] CCACTACAGGTTGGGGTCGGGCATGCGTCCGGAGAAGGGCAAACGAGAGGTCACCAGCACGTCCATGAG

[0039] DML7-b: (Delete 3 bases in the left primer region, delete 9 bases in the right primer region)

[0040] CTCGGATGCCACTACAGGTTGGGGTCGGGCATGCGTCCGGAGAAGGGCAAACGAGAGGTCACCAGCAC

[0041] DML7-c: (Delete 13 bases in the left primer region, delete 19 bases in the right primer region)

[0042] AGGTTGGGGTCGGGCATGCGTCCGGAGAAGGGCAAACGAGAGG

[0043] DML7-d: (Delete 5 bases in the left primer region, delete 7 bases in the right primer region)

[0044] CGGATGCCACTACAGGTTGGGGTCGGGCATGCGTCCGGAGAAGG...