Antibodies specific for cancer associated antigen SM5-1 and uses thereof

Screening and Identification of Human SM5-1 Antigen

1. Construction of cDNA Library of Hepatocellular Carcinoma Cell Line QYC

[0142] This example describes how a human SM5-1 antigen could be isolated. Total RNAs are extracted from hepatocellular carcinoma cell line QYC with Trizol reagents. Then mRNAs are isolated and cDNA synthesized as described (Marken J S. PNAS, 1992, 89:3503-3507). The cDNA is inserted into mammalian transient expression vector pCDM8 (from Invitrogen.) after ligation of the non-self-complementary BstXI adaptors and transformed into the E. coli. MC1061 / P3 (from Invitrogen) by electroporation to construct the cDNA library.

2. Expression and Screening of the cDNA Library

[0143] COS-7 (Invitrogen) cells are transfected with the above acquired cDNA library using Lipofection method. After twelve hours, the cells are digested and plated in new flasks. Seventy-two hours after transfection, the cells are harvested and re-suspended in PBS / 0.5 mM EDTA / 5% FBS containing ...

Screening for Variable Region Gene of a Human Anti-Human SM5-1 Antibody from a Human Antibody Library

[0145] The human antibody library was constructed according to methods described by Marks et al (J. Mol. Biol. 222, 581-597), Hoogenboom and Winter (J. Mol. Biol, 227, 381-388), Haidais C G et al (J. Immunol. Methods., 2001, Nov. 1; 257(1-2): 185-202), Griffiths, A. D. et al. (EMBO J., 13, 3245-3260 (1994)); Nissim, A, et al. (EMBO J, 13, 692-698 (1994)). The recovered antibody library was added to 14 ml fresh LB media and cultured for 16 h in a 50 l triangle bottle at 37° C. The bacteria were centrifuged at 12,000 rpm for 10 min. The supernatant was transferred to a sterile 50 ml centrifuge tube and stored for later use and the titer should be higher than 2×1011.

[0146] A hybrid cell formed from QYC cells (p230 expressing) and B16 (melanoma) cells was used for selecting phage particles that expressed human antibody to the p230 antigen (SM5-1 antigen). QYC cells have been deposited ...

The Expression of the Human Antibody Against Human SM5-1 Antigen

1. The Construction of Expression Vector

[0155] Using PCR method, XbaI site and the signal peptide of mAb OKT3 were added to the 5′end of the heavy chain variable region gene (VH) of huSM5-1 and a NheI site added to the 3′end. The amino acid sequence of mAb OKT3 signal peptide is MDFQVQIFSFLLISASVIISRG (SEQ ID NO:13), and the nucleotide sequence of mAb OKT3 signal peptide is ATGGATTTTCAGGTGCAGATTTTCAGCTTCCTGCT AATCAGTGCCTCAGTCATAATATCCAGAGGAG (SEQ ID NO:14). The PCR product was cloned into pGEM-T vector and its sequence was verified. The VH was excised by XbaI and NheI digestion and then, inserted into the expression vector pMG18-3K shown in FIG. 1 (from Development of tools for environmental monitoring based on incp-9 plasmid sequences. A. Greated, R. Krasowiak, M. Titok, C. M. Thomas school of biological sciences, university of Bermingham, Edgbaston, Birmingham B15 2TT, UK and Faculty of Biology, Dept of Microbiolog...