Codon optimized rpgrorf15 genes and uses thereof
a technology of rpgrorf15 and rpgrorf15, which is applied in the field of cohrpgrorf15 genes, can solve the problems of poor sequence stability of wild type sequences, and achieve the effect of robust increase of cohrpgrorf15
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Examples
example 1
imization of RPGRorf15 cDNA Sequence with Improved Stability
[0155]The human Retinitis Pigmentosa GTPase Regulator open reading frame 15 (hRPGRorf15) sequence contains a highly repetitive, purine-rich region that leads to sequence instability during transgene cassette cloning and plasmid amplification. The hRPGRorf15 cDNA sequence (NCBI Reference Sequence NM_001034853.1) was codon optimized to generate an RPGRorf15 cDNA sequence with increased expression in human cells and improved sequence stability
[0156]The codon optimized nucleotide sequence is set forth below:
(SEQ ID NO: 10)ATGAGAGAGCCTGAAGAGCTGATGCCTGATAGCGGAGCAGTGTTTACCTTTGGGAAGAGCAAGTTCGCAGAGAATAACCCTGGGAAATTCTGGTTTAAGAACGACGTGCCCGTGCACCTGAGCTGTGGCGATGAGCACTCCGCCGTGGTGACAGGCAACAATAAGCTGTACATGTTCGGCTCTAACAATTGGGGACAGCTGGGCCTGGGAAGCAAGTCCGCCATCAGCAAGCCAACCTGCGTGAAGGCCCTGAAGCCCGAGAAGGTGAAGCTGGCCGCCTGTGGCAGAAACCACACACTGGTGAGCACCGAGGGAGGAAACGTGTACGCAACAGGAGGCAACAATGAAGGCCAGCTGGGCCTGGGCGACACAGAGGAGAGGAATACCTTTCACGTGATCAGCTTCTTTACCTC...
example 2
n and Activity of Human RPGRorf15 Protein Expressed from Codon Optimized hRPGRorf15 of SEQ ID NO:1
[0164]Expression and activity of human RPGRorf15 protein expressed from pAAV-GRK-cohRPGRorf15-5V40 was assessed in transfected HEK293T cells.
[0165]Briefly, HEK293T cells were seeded in 12-well plates at 2.0×10{circumflex over ( )}5 cells / well in 1.0 ml DMEM / 10% FBS media. HEK293T cells were used due to their high transfectability and protein expression. The next day, 1.0 μg AAV plasmid DNA complexed with 3.0 μl FuGene6 (Cat. #E2691, Promega, Madison, Wis.) was added to the cells in duplicate wells. Two days after transfection, the cells were washed with PBS and lysed in 0.25 ml 1× Passive Lysis Buffer (Promega) containing 1× Halt Protease Inhibitor (ThermoFisher), rocking for 15 minutes at room temperature. Cell debris was pelleted by centrifugation in a microcentrifuge at 12,000 g for 10 minutes at 4° C. The supernatant was collected and stored at −20° C. No-plasmid and pAAV-PGK promot...
example 3
l Expression of hRPGRorf15 in an In Vitro Model of Human XLRP
[0169]A human in vitro model system was generated to evaluate correction of the X-linked Retinitis Pigmentosa (XLRP) disease phenotype with the codon optimized human RPGRorf15 nucleic acid having the nucleotide sequence of SEQ ID NO:1. To that end, an AAV vector was constructed comprising the nucleotide sequence of SEQ ID NO:1 driven by the human G-protein coupled receptor rhodopsin kinase 1 (hGRK) promoter (i.e. the AAV vector backbone described in Examples 1 and 2, having the sequence of SEQ ID NO:5) and a variant capsid protein having the amino acid sequence of SEQ ID NO:9. The hGRK promoter was chosen to limit expression of RPGRorf15 to photoreceptors.
[0170]Peripheral blood mononuclear cells (PBMCs) were isolated from whole blood drawn from individuals with XLRP and reprogrammed into induced pluripotent stem cells (iPSCs) using the CytoTune iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific, Waltham, Mass.). Pl...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap